Please wait, while we are loading the content...
| Content Provider | Springer Nature : BioMed Central |
|---|---|
| Author | Zhang, Haiyang Miao, Hongmei Wei, Libin Li, Chun Duan, Yinghui Xu, Fangfang Qu, Wenwen Zhao, Ruihong Ju, Ming Chang, Shuxian |
| Abstract | Background Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. Results For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. Conclusions SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame. |
| Related Links | https://bmcplantbiol.biomedcentral.com/counter/pdf/10.1186/s12870-018-1503-2.pdf |
| Ending Page | 12 |
| Page Count | 12 |
| Starting Page | 1 |
| File Format | HTM / HTML |
| ISSN | 14712229 |
| DOI | 10.1186/s12870-018-1503-2 |
| Journal | BMC Plant Biology |
| Issue Number | 1 |
| Volume Number | 18 |
| Language | English |
| Publisher | BioMed Central |
| Publisher Date | 2018-11-22 |
| Access Restriction | Open |
| Subject Keyword | Plant Sciences Agriculture Tree Biology Sesamum indicum L Curly leaf Indehiscent capsule Association mapping SNP/InDel discovery KAN1 |
| Content Type | Text |
| Resource Type | Article |
| Subject | Plant Science |
| Journal Impact Factor | 4.3/2023 |
| 5-Year Journal Impact Factor | 5.2/2023 |
National Digital Library of India (NDLI) is a virtual repository of learning resources which is not just a repository with search/browse facilities but provides a host of services for the learner community. It is sponsored and mentored by Ministry of Education, Government of India, through its National Mission on Education through Information and Communication Technology (NMEICT). Filtered and federated searching is employed to facilitate focused searching so that learners can find the right resource with least effort and in minimum time. NDLI provides user group-specific services such as Examination Preparatory for School and College students and job aspirants. Services for Researchers and general learners are also provided. NDLI is designed to hold content of any language and provides interface support for 10 most widely used Indian languages. It is built to provide support for all academic levels including researchers and life-long learners, all disciplines, all popular forms of access devices and differently-abled learners. It is designed to enable people to learn and prepare from best practices from all over the world and to facilitate researchers to perform inter-linked exploration from multiple sources. It is developed, operated and maintained from Indian Institute of Technology Kharagpur.
Learn more about this project from here.
NDLI is a conglomeration of freely available or institutionally contributed or donated or publisher managed contents. Almost all these contents are hosted and accessed from respective sources. The responsibility for authenticity, relevance, completeness, accuracy, reliability and suitability of these contents rests with the respective organization and NDLI has no responsibility or liability for these. Every effort is made to keep the NDLI portal up and running smoothly unless there are some unavoidable technical issues.
Ministry of Education, through its National Mission on Education through Information and Communication Technology (NMEICT), has sponsored and funded the National Digital Library of India (NDLI) project.
| Sl. | Authority | Responsibilities | Communication Details |
|---|---|---|---|
| 1 | Ministry of Education (GoI), Department of Higher Education |
Sanctioning Authority | https://www.education.gov.in/ict-initiatives |
| 2 | Indian Institute of Technology Kharagpur | Host Institute of the Project: The host institute of the project is responsible for providing infrastructure support and hosting the project | https://www.iitkgp.ac.in |
| 3 | National Digital Library of India Office, Indian Institute of Technology Kharagpur | The administrative and infrastructural headquarters of the project | Dr. B. Sutradhar bsutra@ndl.gov.in |
| 4 | Project PI / Joint PI | Principal Investigator and Joint Principal Investigators of the project |
Dr. B. Sutradhar bsutra@ndl.gov.in Prof. Saswat Chakrabarti will be added soon |
| 5 | Website/Portal (Helpdesk) | Queries regarding NDLI and its services | support@ndl.gov.in |
| 6 | Contents and Copyright Issues | Queries related to content curation and copyright issues | content@ndl.gov.in |
| 7 | National Digital Library of India Club (NDLI Club) | Queries related to NDLI Club formation, support, user awareness program, seminar/symposium, collaboration, social media, promotion, and outreach | clubsupport@ndl.gov.in |
| 8 | Digital Preservation Centre (DPC) | Assistance with digitizing and archiving copyright-free printed books | dpc@ndl.gov.in |
| 9 | IDR Setup or Support | Queries related to establishment and support of Institutional Digital Repository (IDR) and IDR workshops | idr@ndl.gov.in |
|
Loading...
|